Η Απάτη Επιβεβαιώθηκε: Το τεστ PCR Δεν Εντοπίζει το SARS-CoV-2. Τι περιμένουν οι Δικαστές, για να ενεργήσουν με δική τους πρωτοβουλία;

Η Απάτη Επιβεβαιώθηκε: Το τεστ PCR Δεν Εντοπίζει το SARS-CoV-2. Τι περιμένουν οι Δικαστές, για να ενεργήσουν με δική τους πρωτοβουλία;

19 Δεκεμβρίου, 2020 2 Από Καλλιόπη Σουφλή
Μοιράστε το

- 1,557 προβολές ( Μέτρηση έως 15:09:00 )

Και τα συμπεράσματα είναι εξαιρετικά σοβαρά: κανένας από τους επτά (7) «ανθρώπινους κοροναϊούς» δεν έχει πραγματικά απομονωθεί και όλες οι αλληλουχίες των εκκινητών των αντίστοιχων PCR τους, καθώς και εκείνες ενός μεγάλου αριθμού θραυσμάτων των υποτιθέμενων γονιδιωμάτων τους, βρίσκονται σε διαφορετικές περιοχές στο ανθρώπινο γονιδίωμα αλλά και σε γονιδιώματα βακτηρίων και αρχαίων

ΟΛΟΙ ΟΙ ΑΡΙΘΜΟΙ ΤΩΝ «ΚΡΟΥΣΜΑΤΩΝ» , «ΜΟΛΥΣΜΕΝΩΝ», «ΑΣΘΕΝΩΝ», «ΑΣΥΜΠΤΩΜΑΤΙΚΩΝ»  Ή «ΘΑΝΑΤΩΝ ΑΠΟ ή ΜΕ COVID-19» ΣΤΕΡΟΥΝΤΑΙ ΕΠΙΣΤΗΜΟΝΙΚΗΣ ΒΑΣΗΣ ΚΑΙ ΟΛΑ ΤΑ «ΘΕΤΙΚΑ» ΕΙΝΑΙ  Ψ Ε Υ Δ Ω Σ  ΘΕΤΙΚΑ

 

 

Οι ποιοί; Οι δικαστές;

Και να ενεργήσουν με… δική τους πρωτοβουλία;;;

Και να χάσουν τις θέσεις τους και τους παχυλούς μισθούς τους;

Και να τους τραβήξει τ’ αυτί η … στοά…;

Και να τους βγάλει τις διαστροφές στη φόρα;;;

Ας το συνειδητοποιήσουμε ότι ΔΕΝ ΥΠΑΡΧΕΙ ΔΙΚΑΙΟΣΥΝΗ.

ΕΙΝΑΙ ΠΟΥΛΗΜΕΝΗ, ΕΙΝΑΙ ΔΙΑΠΛΕΚΟΜΕΝΗ, ΕΙΝΑΙ ΔΙΕΦΘΑΡΜΕΝΗ, ΕΙΝΑΙ Ο ΠΡΩΤΟΣ ΠΥΛΩΝΑΣ ΠΟΥ ΣΤΗΡΙΖΕΙ ΤΗΝ ΠΟΛΙΤΙΚΗ ΚΑΙ ΟΙΚΟΝΟΜΙΚΗ ΜΑΦΙΑ.

Και φυσικά μην ξεχάσουμε και την ΙΑΤΡΙΚΗ ΜΑΦΙΑ. Τα χρυσοπληρωμένα ΥΠΟΚΕΙΜΕΝΑ, ΠΟΥ ΣΤΟΝ ΒΩΜΟ ΤΟΥ ΧΡΗΜΑΤΟΣ, ΓΕΝΟΚΤΟΝΟΥΝ ΛΑΟΥΣ. Και μην ξεχάσουμε και την ΔΗΜΟΣΙΟΓΡΑΦΙΚΗ ΜΑΦΙΑ – ΠΟΡΝΕΙΑ…

Και μην ξεχάσουμε και τα ΣΩΜΑΤΑ ΑΣΦΑΛΕΙΑΣ… ΣΤΡΑΤΟ ΚΑΙ ΑΣΤΥΝΟΜΙΑ… όχι όλους… τις ηγεσίες και τους ψυχοπαθείς ΜΠΑΤΣΟΥΣ.

ΑΝ ΟΛΟΙ ΑΥΤΟΙ ΔΕΝ ΣΦΑΧΤΟΥΝ ΣΤΟ ΓΟΝΑΤΟ, ΑΠΟ ΤΟΥΣ ΛΑΟΥΣ, ΟΙ ΛΑΟΙ ΔΕΝ ΕΧΟΥΝ ΜΕΛΛΟΝ.

 

Καλλιόπη Σουφλή

Η Απάτη Επιβεβαιώθηκε: Το τεστ PCR Δεν Εντοπίζει το SARS-CoV-2. Τι περιμένουν οι Δικαστές, για να ενεργήσουν με δική τους πρωτοβουλία;

Δημοσιεύτηκε την 14 Δεκεμβρίου 2020 δείτε το άρθρο εδώ: The Scam Has Been Confirmed: PCR Does Not Detect SARS-CoV-2

https://www.greenmedinfo.com/blog/scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2  [1]

 Αναρτήθηκε από: Δημοσιογράφο GMI

 

Μη επίσημη αγγλική μετάφραση του άρθρου «Απάτες και παραποιήσεις στον ιατρικό τομέα» που δημοσιεύθηκε αρχικά στο  https://www.dsalud.com/reportajes/fraudes-y-falsedades-en-el-ambito-medico/

Οι γενετικές αλληλουχίες που χρησιμοποιούνται στη PCR για την ανίχνευση κρουσμάτων ύποπτων για SARS-CoV-2, και για τη διάγνωση περιπτώσεων ασθένειας και θανάτου που αποδίδονται στη Covid-19, είναι ίδιες και συναντώνται σε δεκάδες αλληλουχίες του ίδιου του ανθρώπινου γονιδιώματος αλλά και στο γονιδίωμα εκατό περίπου μικροβίων.

Επίσης και τα τμήματα των αλληλουχιών που χρησιμοποιούνται για τους εκκινητές (primers) καθώς επίσης και τα πιο εκτεταμένα θραύσματα που λαμβάνονται τυχαία από το υποτιθέμενο «γονιδίωμα» του «ιού» και ακόμη και τα λεγόμενα «γονίδια-στόχοι» που φέρονται να είναι ειδικά για τον «νέο κοροναϊό».

Το τεστ είναι ΑΧΡΗΣΤΟ και όλα τα “θετικά” αποτελέσματα που έχουν ληφθεί μέχρι στιγμής θα πρέπει να ακυρωθούν επιστημονικά και να κοινοποιηθεί η Ακύρωση τους σε όσους υπέστησαν τις συνέπειες και επηρεάστηκαν και εάν έχουν πεθάνει, στους συγγενείς τους.

Ο Stephen Bustin, ένας από τους κορυφαίους εμπειρογνώμονες στον κόσμο για την PCR, λέει ότι στην πραγματικότητα, κάτω υπό ορισμένες συνθήκες, ο καθένας μπορεί να διαγνωστεί «θετικός»!

Σας προειδοποιούμε συνεχώς από τον Μάρτιο: δεν μπορείτε να διενεργείτε  συγκεκριμένα τεστ για έναν ιό χωρίς να γνωρίζετε τα συστατικά μέρη του ιού που προσπαθείτε να εντοπίσετε.

Και τα συστατικά δεν μπορούν να είναι γνωστά χωρίς προηγουμένως να απομονωθεί / καθαριστεί αυτός ο ιός.

Από τότε συνεχίζουμε να συλλέγουμε στοιχεία ότι κανείς δεν έχει απομονώσει τον ιό που ονομάζουνε SARS-CoV-2 και, το πιο σημαντικό, ότι δεν μπορεί ποτέ να απομονωθεί για τους λόγους που εξηγήσαμε τον περασμένο μήνα (διαβάστε την έκθεση «Μπορείτε να αποδείξετε ότι υπάρχουν παθογόνοι ιοί;» στον ιστότοπό μας – www.dsalud.com -).

Και στην παρούσα έκθεση πρόκειται να προσφέρουμε νέα δεδομένα που δείχνουν ότι η RT-PCR δεν ανιχνεύει το λεγόμενο SARS-CoV-2 όπως είναι γνωστός, αλλά θραύσματα του ανθρώπινου RNA και εκείνα πολλών μικροβίων.

Έχουμε ήδη εξηγήσει τα πολυάριθμα προβλήματα που δημιουργεί η RT-PCR, αναγνωρισμένα από οργανισμούς ή κυβερνήσεις όπως ο Παγκόσμιος Οργανισμός Υγείας- ΠΟΥ ή το Κέντρο Ελέγχου και Πρόληψης Ασθενειών -CDC και από διάσημους διεθνείς εμπειρογνώμονες όπως ο Δρ.Stephen Bustin που θεωρεί ότι τόσο η αυθαιρεσία στον καθορισμό κριτηρίων για τα αποτελέσματα όσο και η επιλογή του αριθμού των κύκλων, είναι ανοησίες επειδή μπορούν να οδηγήσουν τον οποιονδήποτε κάνει το τεστ σε «θετικό» αποτέλεσμα.

Σε αυτήν την έκθεση πρόκειται να προσθέσουμε τα αποτελέσματα μιας συγκεκριμένης έρευνας που κάναμε από τα δεδομένα που δημοσιεύθηκαν στο υποτιθέμενο SARS-CoV-2 και στα πρωτόκολλα που εγκρίθηκαν από τον ΠΟΥ για τη χρήση του RT-PCR καθώς και τα αντίστοιχα δεδομένα για τους υπόλοιπους «ανθρώπινους κοροναϊούς».

Και τα συμπεράσματα είναι εξαιρετικά σοβαρά: κανένας από τους επτά (7) «ανθρώπινους κοροναϊούς» δεν έχει πραγματικά απομονωθεί και όλες οι αλληλουχίες των εκκινητών των αντίστοιχων PCR τους, καθώς και εκείνες ενός μεγάλου αριθμού θραυσμάτων των υποτιθέμενων γονιδιωμάτων τους, βρίσκονται σε διαφορετικές περιοχές στο ανθρώπινο γονιδίωμα αλλά και σε γονιδιώματα βακτηρίων και αρχαίων (archaea), όπως : Shwanella marina JCM, Dialister succinatiphilus, Shigella boydii CDC χοιρινό, Shigella boydii CDC manihotivorans, Leptospira sarikeiensis, Bizionia ψάρια, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix Venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillus koleovorans, tamian fuccidanivorans, Fontibacillua panacisegetis, Ru Bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, cellulosilyticus ruminicola, Nitrosopumilus evryensis και μια μεγάλη λίστα άλλων.

Θα εξηγήσουμε βήμα-βήμα την έρευνα που μας οδήγησε σε ένα τόσο ασυνήθιστο συμπέρασμα.

ΕΧΕΙ ΠΟΤΕ ΑΠΟΜΟΝΩΘΕΙ ΑΝΘΡΩΠΙΝΟΣ ΚΟΡΟΝΑΪΟΣ;

Κατά το πρώτο εξάμηνο του Απριλίου τρέχοντος έτους, όταν η πρώτη έρευνα που διεξήγαμε έδειξε ότι το SARS-CoV-2 δεν είχε απομονωθεί και επειδή όσοι ισχυρίστηκαν ότι το έπραξαν βασίζονταν σε «απομονώσεις» προηγούμενων «ανθρώπινων κοροναϊών», αρχίσαμε να κάνουμε μια εμπεριστατωμένη ανασκόπηση αυτών των ισχυρισμών σχετικά με τις ήδη φερόμενες ως διενεργηθείσες απομονώσεις. Συγκεκριμένα, εξετάσαμε την υποτιθέμενη εργασία απομόνωσης ύποπτων ανθρώπινων κοροναϊών:

229Ε (λέγεται ότι έχει απομονωθεί το 1965), OC43 (το 1967), SARS-CoV (το 2003), NL63 (το 2004), HKU1 (το 2005) και MERSCoV (το 2012). Και αυτά είναι τα αποτελέσματα όπως παρατίθενται κατωτέρω:

Coronavirus 229Ε.

Άρθρο αναφοράς : Dorothy Hamre και John Procknow . A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1:190-193. January 1, 1966.

Επειδή οι συγγραφείς αναφέρονται σε άλλα άρθρα για να εξηγήσουν τη μέθοδο απομόνωσης – την οποία ονομάζουν Complement Fixation – συμβουλευτήκαμε ένα άρθρο αναφοράς για αυτήν τη μέθοδο: αυτό των Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5):931-938, May 1965 [2].

Αυτή είναι μια διαδικασία που έχει ήδη εγκαταλειφθεί αφού χρησιμοποιεί την αντίδραση αντιγόνου-αντισώματος για να ανιχνεύσει το ένα ή το άλλο.

Στην περίπτωση που αντιμετωπίζουμε, ο στόχος ήταν να ανιχνευθούν τα αντιγόνα του υποτιθέμενου νέου ιού, αλλά, όπως έχουμε ήδη εξηγήσει, απαιτούνται ειδικά αντισώματα που δεν μπορούν να ληφθούν την πρώτη φορά που ανιχνεύεται ένας ιός.

Coronavirus OC43.

Άρθρο αναφοράς : Paul Lee  Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub. [3],[3α ]

Αυτό που θεωρήθηκε ως ιϊκό RNA εξήχθη από καλλιέργειες χωρίς καμία απόδειξη ότι το RNA ανήκει σε έναν ιό.

Το εργαλείο που χρησιμοποιήθηκε – ένα κιτ QIAamp – αφαιρεί τα αντιδραστήρια, τους αναστολείς και τους μολυσματικούς παράγοντες, αλλά αυτό που δεν μπορεί να κάνει είναι να προσδιορίσει από πού προέρχεται το εξαγόμενο RNA. Και δεν υπάρχουν έλεγχοι.

Εν συνεχεία ενισχύεται με τη PCR και προσδιορίζεται η αλληλουχία υποθέτοντας (!) ότι είναι γενετικές  πληροφορίες ενός ιού.

Τέλος, ο συγγραφέας εικάζει για τις μεταλλάξεις, τους ανασυνδυασμούς, τους γονότυπους, τη μοριακή εξέλιξη, τα στελέχη και άλλη ορολογία που εμπεριέχει την ιδέα – μη αποδεδειγμένη – ότι η εργασία έγινε με έναν “ιό”.

SARS-CoV Coronavirus.

Άρθρο αναφοράς: JSM Peiris και άλλοι. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003. [4]

Δεν υπάρχει καμία αναφορά στον καθαρισμό στο άρθρο. Δεν υπάρχει καν αναφορά για διήθηση ή φυγοκέντρηση.

Αναφέρεται μόνο ότι «οι ιοί απομονώθηκαν σε εμβρυϊκά ηπατικά κύτταρα πιθήκου από ρινοφαρυγγικές αναρροφήσεις και βιοψίες πνευμόνων δύο ασθενών» .

Δεν υπάρχουν έλεγχοι .

Η μόνη αναφορά είναι για μια «κυτταροπαθητική επίδραση» που αποδίδεται σε έναν ιό και ότι η PCR έγινε για γνωστούς ιούς και ρετροϊούς χωρίς να ληφθούν τα αποτελέσματα.

Τέλος, το RT-PCR πραγματοποιήθηκε με «τυχαίους εκκινητές» και ανιχνεύθηκε μια αλληλουχία «άγνωστης προέλευσης» στην οποία βρίσκεται «μια αδύναμη ομολογία με την οικογένεια coronaviridiae».

Στη συνέχεια, σχεδίασαν εκκινητές για αυτήν την αλληλουχία και κατά τη δοκιμή 44 δειγμάτων από ασθενείς με SARS μόνο 22 εξ’ αυτών διαγνώσθηκαν «θετικοί».

Κορωναϊός NL63.

Άρθρο αναφοράς: Lia van der Hock και άλλοι . Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004. [5]

Οι συγγραφείς δηλώνουν ότι «η ταυτοποίηση άγνωστων παθογόνων με τη χρήση εργαλείων μοριακής βιολογίας είναι δύσκολη επειδή η αλληλουχία-στόχος δεν είναι γνωστή, έτσι ώστε δεν δύναται να σχεδιαστούν συγκεκριμένοι εκκινητές PCR για το συγκεκριμένο γονιδίωμα».

Αυτό που χρησιμοποίησαν είναι ένα εργαλείο που ανέπτυξαν οι ίδιοι ονομάζοντας το VIDISCA το οποίο, σύμφωνα με τους ισχυρισμούς τους, δεν απαιτεί προηγούμενη γνώση της ακολουθίας! Είναι αυτό δυνατόν;

Ας δούμε πώς λειτουργεί: πρώτα ετοιμάζεται η καλλιέργεια όπου αυτοί υποθέτουν ότι υπάρχει ένας ιός λόγω των ενδείξεων «κυτταροπαθητικής επίδρασης».

Η καινοτομία που εισάγεται με αυτήν τη μέθοδο είναι ότι προστίθενται “περιοριστικά ένζυμα”, ένζυμα που κόβουν τα μόρια νουκλεϊνικού οξέος σε ορισμένες θέσεις και πάντα με το ίδιο μήκος.

Με αυτόν τον τρόπο, εάν μετά τη δράση αυτών των ενζύμων παρατηρούν πολλά θραύσματα DNA ή RNA που είναι τα ίδια ή πολύ παρόμοια, συμπεραίνουν ότι προέρχεται από έναν ιό, καθώς το γονιδίωμα του ξενιστή θα παρουσίαζε τυχαίες περικοπές, ενώ το γονιδίωμα του ιού μεγάλο αριθμό αντιγράφων που είναι το ίδιο λόγω της αναπαραγωγής του ιού.

Και είναι σωστή μια τέτοια υπόθεση;

Φυσικά και όχι!

Αυτή η υπόθεση (η οποία προστίθεται στην προηγούμενη υπόθεση ότι υπάρχει ιός) δεν λαμβάνει υπόψη ότι υπάρχουν «σωματίδια που μοιάζουν με ιό», «σωματίδια που μοιάζουν με ρετροϊό», «ενδογενείς ρετροϊοί», «εξωσώματα», «εξωκυτταρικά» σωματίδια ακόμη και μιτοχονδριακό DNA.

Υποθ’εσεις που αρνούνται ότι υπάρχει ένα πλήθος σωματιδίων που έχουν τα ίδια αναπαραγωγικά χαρακτηριστικά σε μεγάλες ποσότητες με τους “ιούς” και επομένως μπορούν να παραποιήσουν τα αποτελέσματα παράγοντας μεγάλο αριθμό πανομοιότυπων αντιγράφων όταν κόβονται από ένζυμα όπως αναγνωρίζεται σε ένα άρθρο της τεχνικής VIDISCA με τίτλο Enhanced bioinformatic profiling of VIDISCA libraries for virus detection and Discovery.

Δημοσιεύτηκε στον τόμο 263 του Virus Research στις 2 Απριλίου 2019, και οι συγγραφείς του – Cormac M. Kinsella et al . – αναγνωρίζουν ότι Δεν αναμένεται πλεονασμός του ένθετου του συστήματος VIDISCA από το υποβάθρο ή το νουκλεϊκό οξύ του ξενιστή, εκτός από αυτό με τα χαρακτηριστικά του “ιού”, δηλαδή τον υψηλό αριθμό αντιγράφων, όπως το μιτοχονδριακό DNA.“.

Κορωναϊός HKU1.

Άρθρο αναφοράς: Patrick CY Woo και άλλοι . Characterization and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Εφημερίδα της ιολογίας (Journal of Virology) , 79, 2, Ιανουάριος 2005. [6]

Το άρθρο ξεκινά, απίστευτα, με τις εξής λέξεις: «Παρά την εκτενή έρευνα σε ασθενείς με λοιμώξεις του αναπνευστικού συστήματος, δεν έχει εντοπιστεί μικροβιολογική αιτία σε σημαντικό  ποσοστό ασθενών . Το RNA εξάγεται από μη καθαρισμένες καλλιέργειες.»

Και χρησιμοποιείται μια δοκιμή PCR με γονίδια κορονοϊού.

Για την αλληλούχιση χρησιμοποιούν δύο βάσεις δεδομένων πρωτεϊνών που οργανώνονται σε οικογένειες, τομείς και λειτουργικές τοποθεσίες –PFAM και INterProScan– σε συνδυασμό με δύο προγράμματα υπολογιστών που εκτελούν «προβλέψεις» για το πώς πρέπει να συνδυαστούν τα νουκλεοτίδια.

Το κείμενο προσθέτει: «Οι αλληλουχίες συναρμολογήθηκαν και επεξεργάστηκαν χειροκίνητα για να παράγουν μια τελική αλληλουχία του ιϊκού γονιδιώματος» . Και για άλλη μια φορά δεν υπάρχουν έλεγχοι.

 

MERS-CoV Coronavirus

Άρθρο αναφοράς : Ali Moh Zaki και άλλοι . Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367: 19, Νοέμβριος 2012. [7]

Το γενετικό υλικό εξάγεται απευθείας από το υπερκείμενο της καλλιέργειας και από το δείγμα των πτυέλων με ένα εργαλείο που ονομάζεται High Puré Viral Nucleic Acid Kit και στη συνέχεια δοκιμάζεται με διαφορετικά PCR για διάφορους γνωστούς μικροοργανισμούς. Δεν υπάρχει αναφορά στον καθαρισμό (purification) και δεν υπάρχουν έλεγχοι.

Εν ολίγοις, αυτό που είχε γίνει με τους πρώτους κοροναϊούς –και με πολλούς άλλους υποτιθέμενους ιούς– είναι η καλλιέργεια υποτιθέμενων μολυσμένων ιστών – οποιαδήποτε «κυτταροπαθητική επίδραση» αποδόθηκε μόνο στην παρουσία ενός ιού – και στη συνέχεια είτε λαμβάνονται ορισμένες πρωτεΐνες οι οποίες χωρίς οποιαδήποτε δοκιμή θεωρούνται «αντιγόνα ιού» και όταν αυτά τα «αντιγόνα» ανιχνεύονται σε καλλιέργειες, ερμηνεύονται ως «απομόνωση» (isolation), ή εξάγονται θραύσματα νουκλεϊκών οξέων υποθέτοντας ότι ανήκουν σε έναν ιό.

Εξηγήσαμε ήδη στο άρθρο που δημοσιεύθηκε στο προηγούμενο τεύχος του περιοδικού ότι, σύμφωνα με τον Dr. Stefan Lanka, το λεγόμενο «κυτταροπαθητικό αποτέλεσμα» είναι στην πραγματικότητα ένα αποτέλεσμα που προκαλείται από τις συνθήκες της ίδιας της καλλιέργειας.

Αυτό αναγνωρίζεται, για παράδειγμα, στο άρθρο Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA που δημοσιεύθηκε στις 15 Αυγούστου 2017 στον ιστότοπο της Nature και υπογράφηκε από τον Andrea Németh και άλλους https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf

H εν λόγω εργασία ότι ορισμένες ουσίες –όπως τα αντιβιοτικά– που προστίθενται στα in vitro πειράματα μπορούν να αναγκάσουν τις κυτταρικές καλλιέργειες να δημιουργήσουν νέες γενετικές αλληλουχίες που δεν είχαν εντοπιστεί στο παρελθόν.

Το γεγονός αυτό είχε ήδη παρατηρηθεί από την κορυφαία γενετίστρια από τη Δρ. Barbara McClintock το 1983 κατά τη διάρκεια της διάλεξης που είχε δώσει όταν της απονεμήθηκε το βραβείο Νόμπελ, όπως φαίνεται στη διεύθυνση https://www.nobelprize.org/uploads/2018/06 / mcclintock- lecture.pdf

Εν κατακλείδι, ΚΑΝΕΝΑΣ ΑΠΟ ΤΟΥΣ ΕΠΤΑ (7) ΥΠΟΤΙΘΕΜΕΝΟΥΣ «ΑΝΘΡΩΠΙΝΟΥΣ ΚΟΡΟΝΟΪΟΥΣ» (HUMAN CORONAVIRUS) ΈΧΕΙ ΠΡΑΓΜΑΤΙΚΑ ΑΠΟΜΟΝΩΘΕΙ (has really been isolated).

Το μόνο πράγμα που διαφέρει μεταξύ τους είναι οι εργαστηριακές διαδικασίες και τεχνικές που έγιναν προοδευτικά πιο εξελιγμένες, οι οποίες, στην περίπτωση αυτή, δεν συνεπάγονταν μεγαλύτερη ακρίβεια, αλλά μεγαλύτερη ικανότητα για εξαπάτηση και αυταπάτη που κατέληξε στην εικονική κατασκευή του SARS-CoV-2.

Και η προφανής συνέπεια της έλλειψης αποδεικτικών στοιχείων για την απομόνωσή του (isolation) είναι ότι αυτοί οι «κοροναϊοί» δεν μπορούν να θεωρηθούν υπεύθυνοι για οποιαδήποτε ασθένεια.

Επιπλέον, όλες οι εξετάσεις/δοκιμές – οποιουδήποτε είδους – με βάση τα υποτιθέμενα συστατικά αυτών των “ιών” (νουκλεϊκά οξέα ή πρωτεΐνες) αποκλείονται εντελώς ως «τεστ λοίμωξης» και ακόμη περισσότερο ως «διαγνωστικά» ασθενειών.

ΠΕΡΙΣΣΟΤΕΡΑ ΑΝΑΠΑΝΤΗΤΑ ΕΡΩΤΗΜΑΤΙΚΑ

Στο προηγούμενο τεύχος συλλέξαμε ήδη τις απαντήσεις που δόθηκαν από τους συγγραφείς πολλών άρθρων που υποτίθεται ότι περιγράφουν την απομόνωση του ιού SARS-CoV-2 με τις απαντήσεις τους παραδέχθηκαν ότι δεν είχαν «καθαρίσει τον ιό»( they had not “purified”), πράγμα που σημαίνει σιωπηρή αναγνώριση ότι ο ιός δεν ήταν απομονωμένος ( the virus was not isolated).

Και τώρα πρόκειται να προσθέσουμε ένα ακόμη στοιχείο: τις απαντήσεις που δόθηκαν από διάφορες αρχές – πολιτικές και υγείας – από διάφορες χώρες σχετικά με τον καθαρισμό και την απομόνωση του SARS-CoV-2.

James McCumiskey – συγγραφέας του βιβλίου The Latest Conspiracy: The Biomedical Paradigm – μας λέει ότι το Εθνικό Εργαστήριο Αναφοράς για Ιούς της Ιρλανδίας (National Virus Reference Laboratory of Ireland -NVR) ζήτησε πληροφορίες σχετικά με αυτό από το Πανεπιστήμιο του Δουβλίνου και το τελευταίο απάντησε ότι «δεν έχει αρχεία που θα μπορούσαν να δώσουν απάντηση το αίτημά τους» .

Ο διευθυντής νομικών υπηρεσιών του Εργαστηρίου επέμεινε στο αίτημά του προς το Πανεπιστήμιο και το πανεπιστήμιο απάντησε ως εξής: «Η θέση του πανεπιστημίου είναι ότι το υλικό της ακαδημαϊκής συζήτησης δεν μπορεί να υπόκειται στον νόμο περί ελευθερίας της πληροφόρησης». Από το αίτημα της NVR προκύπτει ότι δεν έχουν καλλιεργήσει τοn SARS-CoV-2 και δεν τον έχουν καθαρίσει (purified).

Δηλώνουν μόνον ότι έχουν «εντοπίσει  RNA του SARS-CoV-2 σε διαγνωστικά δείγματα».

Στις 22 Ιουνίου, μια ομάδα εμπειρογνωμόνων έστειλε ένα αίτημα διαβούλευσης με παρόμοιο περιεχόμενο στον πρωθυπουργό της Βρετανίας Μπόρις Τζόνσον.

Η επιστολή υπογράφηκε από τον Δρ.Kevin Corbett, Piers Corbyn – καθηγητή στο Imperial College London -, τον μηχανικό και ανεξάρτητο ερευνητή – τον οποίο πήραμε συνέντευξη στο περιοδικό εκείνη την εποχή – David Crowe , Dr.Andrew Kaufman , καθηγητή βιολογίας του Εδιμβούργου Roger Watson και τον βιολόγο και χημικό David Rasnick και μέχρι σήμερα δεν έχουν ακόμη λάβει απάντηση!

Ένα άλλο παρόμοιο αίτημα – σε αυτήν την περίπτωση προς το Εθνικό Συμβούλιο Έρευνας του Καναδά (National Research Council of Canada NRC)- έλαβε την ακόλουθη απάντηση: «Δεν καταφέραμε να πραγματοποιήσουμε πλήρη αναζήτηση των αρχείων του NRC, οπότε λυπούμαστε που σας πληροφορούμε ότι δεν έχουν εντοπιστεί αρχεία που να ανταποκρίνονται στο αίτημά σας».

Θα προσθέσουμε ότι δύο δημοσιογράφοι έχουν στείλει παρόμοια αιτήματα – βάσει του νόμου περί ελευθερίας της πληροφόρησης (Freedom of Information Act) – σε διάφορα ιδρύματα στον Καναδά, τη Νέα Ζηλανδία, την Αυστραλία, τη Γερμανία, το Ηνωμένο Βασίλειο και τις Ηνωμένες Πολιτείες, και μέχρι τις 5 Σεπτεμβρίου, δώδεκα ιδρύματα απάντησαν, όλες οι απαντήσεις δείχνουν το ίδιο πράγμα: ότι δεν έχουν κανένα αρχείο εργασίας που να περιγράφει την απομόνωση του  ιού που υποτίθεται ότι προκαλεί το Covid-19. Μπορείτε να δείτε τις λεπτομέρειες και τις απαντήσεις στο σύνδεσμο  https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-of-covid-19-virus-isolation/

ΑΝΑΖΗΤΩΝΤΑΣ ΤΗΝ ΠΡΟΕΛΕΥΣΗ ΤΟΥ ΨΕΥΤΙΚΟΥ ΓΟΝΙΔΙΩΜΑΤΟΣ

Το ερώτημα που θέσαμε στον εαυτό μας ήταν: εάν οι γενετικές αλληλουχίες που έχουν δημοσιευτεί δεν ανήκουν – όπως ισχυρίζονται – σε νέους ιούς, τότε από πού προέρχονται;

Και για να προσπαθήσουμε να απαντήσουμε σε αυτήν την ερώτηση, αποφασίσαμε να πραγματοποιήσουμε μια αναζήτηση με ένα πρόγραμμα υπολογιστή που ονομάζεται Basic Local Alignment Search Tool (BLAST) , ένα εργαλείο αναζήτησης για την ευθυγράμμιση γενετικών αλληλουχιών που μας επιτρέπει να συγκρίνουμε μια δεδομένη ακολουθία με όλες τις ακολουθίες που είναι αποθηκευμένες στα Εθνικά Ινστιτούτα Υγείας των Ηνωμένων Πολιτειών (είναι δημόσιο και μπορείτε να συμβουλευτείτε τη διεύθυνση https://blast.ncbi.nlm.nih.gov/Blast.cgi ).

Εξηγούμε βήμα προς βήμα τι κάναμε έτσι ώστε οι αναγνώστες μας να μπορούν να επαναλάβουν την αναζήτηση και οι ίδιοι και να ελέγξουν τα αποτελέσματα.

Αρχικά συλλέξαμε όλους τους εκκινητές των PCR που περιγράφονται στα πρωτόκολλα που φιλοξενούνται στον ιστότοπο του Παγκόσμιου Οργανισμού Υγείας-ΠΟΥ κατά τον χρόνο που ήταν αυτά:

Πρωτόκολλο CDC (Κέντρα Ελέγχου και Πρόληψης Νοσημάτων) της Κίνας : χρησιμοποιεί γονίδια ORF1ab και N ως στόχο.

Πρωτόκολλο του Ινστιτούτου Pasteur (Γαλλία): χρησιμοποιεί δύο τμήματα του RdRP (το οποίο υποτίθεται ότι είναι ειδικό για το SARS.CoV-2)

Πρωτόκολλο CDC (Κέντρα Ελέγχου και Πρόληψης Νοσημάτων) των Ηνωμένων Πολιτειών : χρησιμοποιεί τρία τμήματα του Ν γονιδίου.

Πρωτόκολλο του Εθνικού Ινστιτούτου Λοιμωδών Νοσημάτων της Ιαπωνίας (National Institute of Infectious Diseases of Japan): είναι το μόνο που έχει ως στόχο το γονίδιο S μαζί με άλλα γονίδια που υποτίθεται ότι είναι κοινά με άλλους κοροναϊούς.

Charite Protocol ( Γερμανία): χρησιμοποιεί τα γονίδια E, N και RdRP.

Πρωτόκολλο Πανεπιστημίου του Χονγκ Κονγκ : χρησιμοποιεί γονίδια ORF1b-nsp14 και N.

Πρωτόκολλο Εθνικού Ινστιτούτου Υγείας Ταϊλάνδης: χρησιμοποιεί το γονίδιο Ν.

Στη συνέχεια, εισαγάγαμε την αλληλουχία των εκκινητών – αυτή που δείχνει την αρχή της αλληλουχίας που θα ανιχνευθεί (προς τα εμπρός) και αυτή που δείχνει την τελική (αντίστροφη) – στο BLAST, ώστε να μπορεί να τα αναζητήσει σε δύο βάσεις δεδομένων: συλλογή γονιδιωμάτων μικροβίων και αυτό που αντιστοιχεί στο ανθρώπινο γονιδίωμα.

ΟΙ ΓΕΝΕΤΙΚΕΣ ΑΛΛΗΛΟΥΧΙΕΣ ΤΟΥ ΑΠΟΚΑΛΟΥΜΕΝΟΥ SARS-COV-2 ΑΝΕΥΡΕΘΗΣΑΝ ΤΟΣΟ ΣΤΟ ΑΝΘΡΩΠΙΝΟ ΓΟΝΙΔΙΩΜΑ ΟΣΟ ΚΑΙ ΣΕ ΠΛΕΙΣΤΑ ΜΙΚΡΟΒΙΑ!

Ας δούμε λεπτομερώς τη διαδικασία λαμβάνοντας ως παράδειγμα τους εκκινητές του γαλλικού πρωτοκόλλου. Όταν εισήλθαμε στον ιστότοπο του BLAST, θέσαμε ως όρο αναζήτησης Microbes ώστε να αναζητήσουμε στις βάσεις δεδομένων του μικροβιακού γονιδιώματος και μετακινηθήκαμε στην επόμενη σελίδα. Στη συνέχεια εμφανίστηκε μια φόρμα στην οποία πληκτρολογήσαμε την αλληλουχία του εμπρόσθιου εκκινητή (forward primer) του γαλλικού πρωτοκόλλου – που είναι ATGAGCTTAGTCCTGTG -, επιλέξαμε την επιλογή Ιδιαίτερα παρόμοιες ακολουθίες (Highly similar sequences ) και πιέσαμε το πλήκτρο BLAST . Λίγα δευτερόλεπτα αργότερα εμφανίστηκαν τα αποτελέσματα – πήραμε ένα στιγμιότυπο οθόνης (εικόνα 1) – και εμφανίστηκαν 100 ακολουθίες μικροβίων – ιδιαίτερα βακτηρίων και αρχαίων (archaea)- με ταύτιση μεταξύ 77% και 100% με ποσοστό ταυτότητας 100%.

Στη συνέχεια επιστρέψαμε στην αρχική σελίδα και ξανά για δεύτερη φορά επιλέξαμε το Human για αναζήτηση του ανθρώπινου γονιδιώματος, επαναλάβαμε την ίδια διαδικασία και μετά από λίγα δευτερόλεπτα εμφανίστηκε το αποτέλεσμα το οποίο καταγράψαμε ξανά (εικόνα 2). Και αποδεικνύεται ότι η αλληλουχία που εισήχθη συμπίπτει με 74 αλληλουχίες του ανθρώπινου γονιδιώματος , με ταύτιση μεταξύ 66% και 100% και ποσοστό ταυτότητας 100%.

Και αυτό αποδεικνύει ότι η αλληλουχία αυτού του εμπρόσθιου εκκινητή της PCR που υποτίθεται ότι είναι ειδική για το SARS-CoV-2 αντιστοιχεί στην πραγματικότητα σε 74 θραύσματα του ανθρώπινου γονιδιώματος και εκατό μικροβιακά θραύσματα επίσης!

Στη συνέχεια αποφασίσαμε να επαναλάβουμε τη λειτουργία αλλά με τον τελικό ή ανάστροφο εκκινητή (reverse primer) – που είναι CTCCCTTTGTGTGTGT – και τα αποτελέσματα ήταν παρόμοια.

Δεδομένου ότι αυτές ήταν πολύ μικρές σε μήκος αλληλουχίες – περίπου είκοσι γενετικά γράμματα ή νουκλεοτίδια – αποφασίσαμε να δοκιμάσουμε ξανά αλλά με την αλληλουχία στόχο που ορίζεται από αυτούς τους δύο εκκινητές, δηλαδή την αλληλουχία του υποτιθέμενου SARS-CoV-2 γονιδιώματος που βρίσκεται μεταξύ του εμπρόσθιου και ανάστροφου εκκινητών.

Ασφαλώς, για αυτόν τον έλεγχο χρειαζόμασταν την αλληλουχία που ισχυρίζονται επίσημα ότι είναι το «γονιδίωμα SARS-CoV-2» και παρόλο που χιλιάδες εργαστήρια ισχυρίζονται ότι το έχουν απομονώσει και αλληλουχίσει – έναν ψεύτικο ισχυρισμό όπως έχουμε εξηγήσει σε προηγούμενες εκθέσεις – αποφασίσαμε να μεταβούμε στην ιστοσελίδα του National Center for Biotechnology Information: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903

Μόλις φτάσαμε εκεί, εντοπίσαμε την «αλληλουχία στόχο», ένα τμήμα 108 νουκλεοτιδίων που βρίσκεται μεταξύ των θέσεων 12.690 και 12.797 του «γονιδιώματος», το οποίο περιγράφεται ως εξής:

ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG .

Με αυτή την αλληλουχία επαναλάβαμε τα βήματα που περιγράφηκαν προηγουμένως και τα αποτελέσματα ήταν για μια ακόμα φορά εκπληκτικά αφού εμφανίστηκαν και πάλι εκατό μικροβιακές αλληλουχίες με ποσοστό αντιστοιχίας 100% και τέσσερις αλληλουχίες του ανθρώπινου γονιδιώματος με ποσοστό ταυτότητας μεταξύ 83% και 95%.

Οι αντιστοιχίσεις ήταν επομένως ασθενέστερες, αλλά το σημαντικό είναι ότι συνεχίζαμε να βρίσκουμε τμήματα της υποτιθέμενης «αλληλουχίας στόχου» του SARS-CoV-2 τόσο στα μικρόβια όσο και στο δικό μας γονιδίωμα.

Πραγματικά έκπληκτοι κάναμε ένα ακόμη βήμα και δοκιμάσαμε με το γονίδιο που θεωρείτο εκείνη την εποχή ως το πιο ειδικό του SARS-CoV-2, το γονίδιο Ε που υποτίθεται ότι δημιουργεί τις πρωτεΐνες περιβλήματος και βρίσκεται μεταξύ των θέσεων 26.245 και 26.472:

ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCT ΤTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTG TTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA .

Επαναλάβαμε, με αυτή την αλληλουχία, τα βήματα που έχουν ήδη περιγραφεί και το αποτέλεσμα ήταν ακόμη πιο εκπληκτικό, διότι παρά το μήκος του εμφανίστηκαν εκατοντάδες μικροβιακές αλληλουχίες με ποσοστό ταυτότητας 100% και 10 αλληλουχίες του ανθρώπινου γονιδιώματος με ποσοστό ταυτότητας μεταξύ 80% και 100% .

Και παρόμοια αποτελέσματα ελήφθησαν με ένα θραύσμα που επιλέχθηκε τυχαία και με το γονίδιο Ν που λένε ότι αντιστοιχεί στις πρωτεΐνες του νουκλεοκαψιδίου SARS-CoV-2.

Τελικά αποφασίσαμε να δοκιμάσουμε με το γονίδιο S που λέγεται ότι δημιουργεί τις δομικές πρωτεΐνες «ακίδων» που είναι το κλειδί για την είσοδο στο κύτταρο και στη συνέχεια θεωρήθηκε ότι είναι το πιο ειδικό γονίδιο SARS-CoV-2. Δεδομένου ότι είναι ένα γονίδιο του οποίου η ακολουθία είναι πολύ μεγαλύτερη – 3821 νουκλεοτίδια μεταξύ των θέσεων 21.563 και 25.384 – δοκιμάσαμε με δύο θραύσματα που επιλέχθηκαν τυχαία μέσα σε αυτό το γονίδιο και το πρώτο – TTGGCAAAATTCAAGACTCACTTTC – είχε ως αποτέλεσμα άλλες εκατοντάδες μικροβιακές αλληλουχίες και 93 αλληλουχίες του ανθρώπινου γονιδιώματος και το δεύτερο – CTTGCTGCTACTAAATGCAGAGTGTεκατό μικροβιακές αλληλουχίες και 90 του ανθρώπινου γονιδιώματος.

Τελικά αποφασίσαμε να δοκιμάσουμε με τους εκκινητές του Πρωτοκόλλου της Ιαπωνίας, το μοναδικό που περιλαμβάνει τις αλληλουχίες στόχου του γονιδίου S και, ο αναγνώστης θα είχε ήδη μαντέψει, τα αποτελέσματα ήταν για μια ακόμη φορά παρόμοια: εκατό μικροβιακές αλληλουχίες και 93 αλληλουχίες του ανθρώπινου γονιδιώματος με ποσοστό ταυτότητας μεταξύ 94,12% και 100%!

ΣΥΜΠΕΡΑΣΜΑΤΑ

Η συνέπεια όλων αυτών που μόλις εξηγήσαμε είναι σαφής και άμεση: ΔΕΝ ΥΠΑΡΧΕΙ ΕΓΚΥΡΟ ΤΕΣΤ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ SARS-COV-2 , ούτε αντισωμάτων ή αντιγόνων ούτε RT-PCR. Και συμπεριλάβαμε αυτά που βασίζονται στο υποτιθέμενο γονίδιο που κωδικοποιεί την πρωτεΐνη S1 ή spike (ακίδα).

Και αυτό σημαίνει ότι:

ΟΛΟΙ ΟΙ ΑΡΙΘΜΟΙ ΤΩΝ «ΚΡΟΥΣΜΑΤΩΝ» , «ΜΟΛΥΣΜΕΝΩΝ», «ΑΣΘΕΝΩΝ», «ΑΣΥΜΠΤΩΜΑΤΙΚΩΝ»  Ή «ΘΑΝΑΤΩΝ ΑΠΟ ή ΜΕ COVID-19» ΣΤΕΡΟΥΝΤΑΙ ΕΠΙΣΤΗΜΟΝΙΚΗΣ ΒΑΣΗΣ ΚΑΙ ΟΛΑ ΤΑ «ΘΕΤΙΚΑ» ΕΙΝΑΙ Ψ Ε Υ Δ Ω Σ ΘΕΤΙΚΑ, 

κάτι που θα πρέπει να κοινοποιηθεί στους άμεσα θιγόμενους και αυτοί που είναι υπεύθυνοι για αυτή την κατάσταση πρέπει να λογοδοτήσουν.

Τελειώνουμε προσθέτοντας ότι ακόμη και ο ίδιος ο ΠΟΥ δεν πιστεύει πραγματικά σε αυτά τα τεστ.

Απλώς διαβάστε το έγγραφο που δημοσιεύθηκε τον περασμένο Σεπτέμβριο ως εργαστηριακός οδηγός για το SARS-CoV-2 με τίτλο Διαγνωστικά τεστ για το SARS-CoV-2 (Diagnostic tests for SARSCoV-2) – είναι διαθέσιμο στη διεύθυνση https://apps.who.int/iris/rest/bitstreams/1302661/ https://apps.who.int/iris/rest/bitstreams/1302661/retrieve  ανακτήστε – και αναγράφει κυριολεκτικά στη σελίδα 5: «Όποτε είναι δυνατόν, η ύποπτη ενεργός λοίμωξη θα πρέπει να δοκιμάζεται με ένα τεστ ενίσχυσης νουκλεϊκών οξέων (NAAT) όπως το RT-PCR.

Οι δοκιμές NAAT πρέπει να στοχεύουν το γονιδίωμα SARS-CoV-2, αλλά επειδή δεν είναι γνωστή καμία παγκόσμια κυκλοφορία του SARS-CoV-1 μια ακολουθία Sarbecovirus (υποτίθεται ότι περιλαμβάνει τουλάχιστον πέντε κοροναϊούς ανθρώπου και ζώου συμπεριλαμβανομένων των SARS-CoV-1 και SARS-Cov-2) είναι επίσης ένας λογικός στόχος».

Δηλαδή, ο ΠΟΥ συμφωνεί να  χρησιμοποιούνται μη ειδικές ακολουθίες για την ανίχνευση του SARS-CoV-2.

Όμως δεν είναι μόνον αυτό, έχει και συνέχεια, το εγχειρίδιο του ΠΟΥ αναφέρει παρακάτω, «Μια βέλτιστη διάγνωση αποτελείται από μια δοκιμή NAAT με τουλάχιστον δύο στόχους ανεξάρτητους από το γονιδίωμα του SARS-CoV-2. Ωστόσο, σε περιοχές όπου η μετάδοση είναι ευρέως διαδεδομένη, ένας απλός αλγόριθμος ενός στόχου μπορεί να χρησιμοποιηθεί.»

Το εγχειρίδιο του ΠΟΥ αναφέρει: «Ένα ή περισσότερα αρνητικά αποτελέσματα δεν αποκλείουν απαραίτητα τη μόλυνση SARS-CoV-2. Υπάρχουν διάφοροι παράγοντες που μπορούν να προκαλέσουν αρνητικό αποτέλεσμα σε ένα μολυσμένο άτομο, συμπεριλαμβανομένης της κακής ποιότητας του δείγματος, καθυστερημένη συλλογή του δείγμα, ανεπαρκής χειρισμός ή τεχνικοί λόγοι που είναι εγγενείς στη δοκιμή, όπως μετάλλαξη του ιού ή αναστολή της PCR».

Αλήθεια, τι περιμένουν οι Δικαστές για να ενεργήσουν με δική τους πρωτοβουλία;

 

Jesus Garcia Blanca

Σημείωση: ο συγγραφέας ευχαριστεί δημόσια τον Juan Pedro Aparicio Alcaraz για την υπομονετική και επιμελή  συνεργατική του εργασία στην αναζήτηση επιστημονικών άρθρων και για την κουραστική δουλειά του με το BLAST.

ΑΥΤΗ Η ΕΚΘΕΣΗ ΕΜΦΑΝΙΖΕΤΑΙ ΣΤΟ (https://www.dsalud.com/revistas/numero-242-noviembre-2020/ )

Αποποίηση ευθυνών : Αυτό το άρθρο δεν προορίζεται να παρέχει ιατρικές συμβουλές, διάγνωση ή θεραπεία. Οι απόψεις που εκφράζονται εδώ δεν αντικατοπτρίζουν απαραίτητα αυτές της GreenMedInfo ή του προσωπικού της.

Δικτυογραφία:

[1].– The Scam Has Been Confirmed: PCR Does Not Detect SARS-CoV-2

https://www.greenmedinfo.com/blog/scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2

[2].–Complement fixation and tissue culture assays for mouse leukemia viruses.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC301351/

[3].– HKU Scholars Hub: Molecular epidemiology of human coronavirus OC43 in Hong Kong

http://hub.hku.hk/handle/10722/131538

[3α].– Molecular Epidemiology of Human Coronavirus OC43 Reveals Evolution of Different Genotypes over Time and Recent Emergence of a Novel Genotype due to Natural Recombination

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3194943/

[4].–Coronavirus as a possible cause of severe acute respiratory syndrome – PubMed

https://pubmed.ncbi.nlm.nih.gov/12711465/

[5].–Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.

[6].–Characterization and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC538593/

 

[7].– (PDF) Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia

https://www.researchgate.net/publication/232279549_Isolation_of_a_Novel_Coronavirus_from_a_Man_with_Pneumonia_in_Saudi_Arabia

[8].–A ‘negative’ coronavirus test result doesn’t always mean you aren’t infected – The Washington Post

https://www.washingtonpost.com/science/2020/03/26/negative-coronavirus-test-result-doesnt-always-mean-you-arent-infected/

 

 

 

Πηγή

(Visited 1,556 times, 1 visits today)

Ετικέτες: ΚΟΡΟΝΟΙΟΣ, Κορυφαίο, ΠΡΩΤΟ ΘΕΜΑ, ΤΕΣΤ Κορονοιου

Μπορείτε να κάνετε δωρεά είτε με τον λογαριασμό σας στην Paypal αν διαθέτετε , η και με Visa ή Mastercard μέσω Paypal

ΕΠΙΣΗΜΑΝΣΗ


Ορισμένα αναρτώμενα από το διαδίκτυο κείμενα ή εικόνες, θεωρούμε ότι είναι δημόσια. Αν υπάρχουν δικαιώματα συγγραφέων, παρακαλούμε ενημερώστε μας, για να τα αφαιρέσουμε. Επίσης, σημειώνεται ότι οι απόψεις του ιστολογίου, μπορεί να μην συμπίπτουν με τα περιεχόμενα του άρθρου. Για τα άρθρα που δημοσιεύονται εδώ, ουδεμία ευθύνη εκ του νόμου φέρουμε, καθώς απηχούν αποκλειστικά τις απόψεις των συντακτών τους και δεν δεσμεύουν καθ’ οιοδνήποτε τρόπο, το ιστολόγιο. Ο διαχειριστής του ιστολογίου, δεν ευθύνεται για τα σχόλια και τους δεσμούς που περιλαμβάνει. Τονίζουμε ότι υφίσταται μετριασμός των σχολίων και παρακαλούμε, πριν δημοσιεύσετε το σχόλιό σας, να έχετε υπόψη σας τα ακόλουθα:
  • Κάθε γνώμη είναι σεβαστή, αρκεί να αποφεύγονται ύβρεις, ειρωνείες, ασυνάρτητος λόγος και προσβλητικοί χαρακτηρισμοί, πολύ περισσότερο σε προσωπικό επίπεδο, εναντίον των συνομιλητών ή και των συγγραφέων, με υποτιμητικές προσφωνήσεις, ύβρεις, υπονοούμενα, απειλές ή χυδαιολογίες.>
  • Μην δημοσιεύετε άσχετα με το θέμα σχόλια.
  • Ο κάθε σχολιαστής, οφείλει να διατηρεί ένα μόνον όνομα ή ψευδώνυμο, το οποίο αποτελεί και την ταυτότητά του σε κάθε συζήτηση.
  • Με βάση τα παραπάνω, η διαχείριση, διατηρεί το δικαίωμα μη δημοσίευσης σχολίων, χωρίς καμία άλλη προειδοποίηση.
  • Επιπλέον σας τονίζουμε, ότι το ιστολόγιο, λειτουργεί σε εθελοντική βάση και ως εκ τούτου, τα σχόλια θα αναρτώνται μόλις αυτό καταστεί δυνατόν.

Μοιράστε το